Reads counts

	Reads number	Keep ratio
Raw reads	191931665	100.00%
Linker reads	169538630	88.33%
Linkers (A-A) and (B-B)	NA	NA
Linkers (A-B) and (B-A)	NA	NA
Uniquely mapped reads	110089408	57.36%
Non-redundant mapped reads	101449665	52.86%
Interchromosomal contacts	17862779	9.31%
Intrachromosomal contacts	83586886	43.55%

Steps:

1. PET extract

Linkers

linker	sequence
AA	GTCGGAGAACCAGTAGCTAGCTACTGGTTCTCCGAC

(1). PET length distribution

PET1

PET2

(2). Flag counts

	Reads number	Ratio
linker unmatchable	22393035	11.67%
intra-molecular linker	169538630	88.33%
inter-molecular linker	0	0.00%
adapter unmatchable	3234324	1.69%
added base to left PET	168576105	87.83%
added base to right PET	167342671	87.19%
left PET length less than threshold	128289	0.07%
left PET length large than threshold	794769	0.41%
right PET length less than threshold	781369	0.41%
right PET length large than threshold	3375339	1.76%
valid reads	168629321	87.86%

Total (raw reads): 191931665

(3). Match score distribution

Linker

Adapter

(4). Adapter inference

Adapter decision graph

Adapter sequence

GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAA

2. build BEDPE

BWA alignment

PET1:

	Reads number	Ratio
unique-mapped	134574945	79.81%
unmapped-mapped	0	0.00%
multiple-mapped	34054376	20.19%

PET2:

	Reads number	Ratio
unique-mapped	133391882	79.10%
unmapped-mapped	0	0.00%
multiple-mapped	35237439	20.90%

Total reads(valid PET extracted): 168629321

Paired unique mapped reads: 110089408 Ratio: 65.28%

3. noise reduce

Ratio of self-ligation and re-ligation

	Reads number	Ratio
normal	109064333	99.07%
self-ligation	299300	0.27%
re-ligation	725775	0.66%

Total reads: 110089408

Count of reads orientation and position relative to fragment

+/+ +/- -/+ -/-

s/s 232271 13429044 13425270 293787

s/t 13416041 211540 273738 13423083

t/s 13827099 275973 214700 13818988

t/t 259886 13400174 13390017 197797

4. remove duplication

Duplicate ratio

duplication duplication / raw duplication / noise-reduced

7614668 3.97% 6.98%

Results:

Ratio of intra and inter chromosome interactions

Reads number Ratio

inter-chromosome 17862779 17.61%

intra-chromosome(long-range) 63869596 62.96%

intra-chromosome(short-range) 19717290 19.44%

Total reads: 101449665

PET span distribution

count mean std min 25% 50% 75% max

83586885 3.6e+06 1.4e+07 4 5577 56180 627154 247829895

Interaction between chromosomes

Global contact map

Contact map of each chromosomes

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X

Run times:

start end duration

extract_PET 2019-07-30 02:43:33 2019-07-30 03:16:01 0:32:28

build_bedpe 2019-07-30 03:16:14 2019-07-30 05:53:23 2:37:09

noise_reduce 2019-07-30 05:53:29 2019-07-30 06:05:30 0:12:01

bedpe2pairs 2019-07-30 10:05:13 2019-07-30 11:00:13 0:55:00

to_hic 2019-07-30 11:00:28 2019-07-30 11:34:45 0:34:17

Pipeline configuration:

[GLOBAL] number_cpus = 16 working_dir = "./pipe-out" log_level = 20 [DATA] input_dir = "./data" fasta = "/public/data/genome/homo_sapiens/hg19/hg19.fa" bwa_index_prefix = "/public/data/genome/homo_sapiens/hg19/bwa_index/hg19" restriction_site = "T^TAA" restriction_name = "MseI" chromosome_file = "hg19" [PROCESSES] keep = 'ALL' is_qc = True [EXTRACT_PET] adapter = "auto" mismatch_adapter = 0.3 linker_A = "GTCGGAGAACCAGTAGCT" linker_B = "" mismatch = 0.3 n_fq_for_infer = 1000 search_start_pos = 70 prob_thresh = 0.75 pet_len_range = (10, 22) pet_cut_len = 20 [BUILD_BEDPE] mapq = 20 iterations = 100 [NOISE_REDUCE] restriction_sites_file = threshold_span = -1 [REMOVE_REDUNDANCY] distance = 0 [QUALITY_CONTROL] report_format = "html" long_range_cutoff = 5000 [RESULT] result_formats = ['.hic'] juicer_tools_jar = "/home/wzxu/S/juicer/juicer_tools_1.11.09_jcuda.0.8.jar" resolutions = [2500000, 1000000, 500000, 250000, 100000, 50000, 25000, 10000, 5000]

Software environment:

Python packages:

appdirs==1.4.3 asciitree==0.3.3 attrs==18.2.0 backcall==0.1.0 biopython==1.70 bokeh==1.0.4 certifi==2019.3.9 chardet==3.0.4 Click==7.0 cloudpickle==0.8.0 ConfigArgParse==0.14.0 cooler==0.8.3 cycler==0.10.0 Cython==0.29.5 cytoolz==0.9.0.1 dask==1.1.2 datrie==0.7.1 decorator==4.4.0 dill==0.2.9 distributed==1.26.0 dlo-hic==0.3.6 docutils==0.14 gitdb2==2.0.5 GitPython==2.1.11 h5py==2.9.0 heapdict==1.0.0 idna==2.8 ipython==7.6.1 ipython-genutils==0.2.0 jedi==0.14.1 Jinja2==2.10 jsonschema==3.0.0 kiwisolver==1.0.1 locket==0.2.0 lsm-db==0.6.4 Mako==1.0.7 MarkupSafe==1.1.1 matplotlib==3.0.3 mmtf-python==1.1.2 msgpack==0.6.1 multiprocess==0.70.7 numpy==1.12.1 olefile==0.46 packaging==19.0 pandas==0.24.1 parso==0.5.1 partd==0.3.9 pexpect==4.7.0 pickleshare==0.7.5 Pillow==5.4.1 prompt-toolkit==2.0.9 psutil==5.5.1 ptyprocess==0.6.0 pyfaidx==0.5.5.2 Pygments==2.4.2 pypairix==0.3.6 pyparsing==2.3.1 pyrsistent==0.14.11 pysam==0.15.2 python-dateutil==2.8.0 pytz==2018.9 PyYAML==3.13 ratelimiter==1.2.0.post0 reportlab==3.5.13 requests==2.21.0 scipy==1.1.0 seaborn==0.9.0 six==1.12.0 smmap2==2.0.5 snakemake==5.4.2 sortedcontainers==2.1.0 tblib==1.3.2 toolz==0.9.0 tornado==5.1.1 traitlets==4.3.2 urllib3==1.24.1 wcwidth==0.1.7 wrapt==1.11.1 zict==0.1.3

Others:

bwa: Version: 0.7.17-r1188 samtools: Version: 1.9 (using htslib 1.9) tabix: Version: 1.9 pairix: Version: 0.3.6 cooler: cooler, version 0.8.3 mafft: v7.407 (2018/Jul/23) coreutils: (GNU coreutils) 8.25